Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология icon

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология





Скачать 419.08 Kb.
НазваниеГемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология
Астахова Дина Анатольевна
Дата конвертации18.06.2013
Размер419.08 Kb.
ТипАвтореферат
На правах рукописи


Астахова Дина Анатольевна


ГЕМОДИНАМИЧЕСКИЕ РАССТРОЙСТВА У ПОРОСЯТ

ПРИ КОЛИБАКТЕРИОЗЕ И ИХ КОРРЕКЦИЯ


06.02.02 – ветеринарная микробиология, вирусология, эпизоотология,

микология с микотоксикологией и иммунология


АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата ветеринарных наук


Новочеркасск - 2010

Работа выполнена в Государственном научном учреждении

Северо-Кавказский зональный научно-исследовательский ветеринарный институт Российской академии сельскохозяйственных наук



Научные руководители:

доктор биологических наук, профессор

Карташов Сергей Николаевич

Официальные оппоненты:

доктор ветеринарных наук, профессор

Паршин Павел Андреевич

доктор ветеринарных наук

Гуркин Анатолий Васильевич

Ведущая организация:

ФГОУ ВПО «Ставропольский государственный аграрный университет»



Защита состоится «13» октября 2010 года в 1200 часов на заседании дис-сертационного совета Д 006.106.01 при Государственном научном учреждении Северо-Кавказский зональный научно-исследовательский ветеринарный институт Российской академии сельскохозяйственных наук.

346421, Ростовская область, г. Новочеркасск, Ростовское шоссе, 0


С диссертацией можно ознакомиться в библиотеке ГНУ Северо-Кавказский зональный научно-исследовательский ветеринарный институт Россельхоз-академии - 346421, Ростовская область, г. Новочеркасск, Ростовское шоссе, 0.


Автореферат разослан «13» сентября 2010 г.


Ученый секретарь

диссертационного совета, д.б.н. А.М. Ермаков


ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ


Актуальность темы. Несмотря на то, что ветеринарная наука и практика накопила огромный арсенал средств и методов профилактики и лечения инфекционных заболеваний, они продолжают наносить огромный экономический ущерб [Амаду Т.Д.,1995; Березина Г.Ю., 2001; Малахов Ю.А., 1993; Терехов В.И. 1999 и др.]. По статистическим данным, большую долю инфекционных заболеваний в свиноводстве занимают желудочно-кишечные болезни молодняка. Ими ежегодно переболевают от 70 до 100% поросят. Вследствие переболевания молодняка на 20-25% снижается потенциал их продуктивности в зрелом возрасте [Овод А.С. и др., 2001]. В свою очередь, значительное место среди них отводится колибактериозу – до 20-25% от всех инфекционных болезней свиней.

По данным различных авторов инцидентность колибактериоза поросят составляет от 6% до 40%. Смертность от этого заболевания достигает 70 % [Коромыслов Г.Ф., Francis D.H.].

Чрезвычайно высокая лабильность клинических признаков при колибактериозе, сложность оперирования большим числом качественных показателей усложняют постановку диагноза на это заболевание для практического ветеринарного врача. Спорными остаются вопросы развития миокардита и сердечнососудистой недостаточности у поросят при колибактериозе, а, следовательно, адекватность назначаемой терапии.

На сегодняшний день не существует объективных методов исследования всех параметров системной гемодинамики у поросят, а тем более систем мониторинга показателей кровообращения.

Научно-практическое разрешение этого вопроса позволит вооружить ветеринарных специалистов современными методами диагностики и лечения поросят, больных колибактериозом.

Для разрешения этого вопроса нами были поставлены следующие цели и задачи.

Цели исследования: усовершенствовать диагностику колибактериоза и терапию поросят при данной патологии.

Достижение намеченной цели осуществлялось решением следующих задач:

1) изучить нозологическую структуру болезней поросят и особенности эпизоотического процесса колибактериоза в условиях Ростовской области;

2) апробировать метод ПЦР диагностики для экспресс-диагностики колибактериоза поросят;

3) определить характер изменений морфологических, биохимических и иммунологических параметров крови у поросят при колибактериозе;

4) определить типы течения колибактериоза поросят в зависимости от состояния сердечнососудистой системы;

5) определить критерии диагностики различных типов колибактериоза поросят;

6) разработать и определить эффективность схем лечения поросят больных колибактериозом различной тяжести течения и типа проявления.

Научная новизна. Уточнены эпизоотические особенности колибактериоза поросят в условиях Ростовской области: распространение, годовая динамика инфекционной патологии, возрастная восприимчивость поросят к этому заболеванию. Впервые выяснены изменения системной гемодинамики у поросят при колибактериозе. Впервые создана научная база для распределения животных при колибактериозе как по степени поражения сердечнососудистой системы, так и по степени обезвоживания животного. Это позволило выделить четыре типа течения колибактериоза, в целях обеспечения адекватной терапии.

Основные положения, выносимые на защиту:

  1. Особенности эпизоотического процесса колибактериоза у поросят, распространение колибактериоза, годовая динамика эпизоотического процесса;

  2. Использование разработанного набора для диагностики колибактериоза поросят в ПЦР;

  3. Основные критерии для диагностики колибактериоза у поросят;

  4. Клинико-гематологические показатели у поросят больных колибактериозом с разной тяжестью течения заболевания;

  5. Методика применения концепции малых гемодинамических профилей, для оценки состояния сердечнососудистой системы при колибактериозе;

  6. Гемодинамические показатели у поросят больных колибактериозом с разной тяжестью течения заболевания;

  7. Схемы лечения колибактериоза с учетом результатов изучения клинических, гематологических и гемодинамических показателей определяющих тяжесть течения заболевания.

Апробация работы. Основные материалы диссертации доложены и обсуждены на ежегодных научно-практических конференциях ФГОУ ВПО «Донской государственный аграрный университет», ГНУ Северо-Кавказский зональный научно-исследовательский ветеринарный институт РАСХН в 2007-2010 гг. и на 3-х всероссийских и международной научно-практических конференциях гг. Ростове, Воронеже, Краснодаре, Новочеркасске.

Реализация результатов исследований. Результаты исследований используются при чтении лекций и проведении лабораторно-практических занятий по микробиологии и патанатомиии в ФГОУ ВПО «Донской государственный аграрный университет», в работе Ростовской областной ветеринарной лаборатории, СББЖ г. Новочеркасска, ветеринарной клиники «Вита» г. Шахты, внедрены в ЗАО «Батайское» Азовского района и ОАО «Южное» Сальского района Ростовской области.

Публикации по теме. По материалам диссертационной работы опубликовано 10 научных работ, из них 2 – в рецензируемых изданиях, рекомендованных ВАК РФ.

Практическая значимость. Получен научный материал, позволяющий объективно оценить тяжесть поражения миокарда и сердечнососудистой системы при колибактериозе у поросят. По результатам исследований разработаны и предложены для диагностики и определения степени поражения миокарда реографические тесты, которые позволяют объективно оценить выраженность и направленность нарушений гомеостаза при колибактериозе.

Разработаны и предложены производству способы эффективной терапии поросят, больных колибактериозом, в зависимости от тяжести течения заболевания, степени обезвоживания организма и поражения миокарда.

Структура и объем работы. Диссертация изложена на 140 страницах текста компьютерного исполнения, состоит из введения, обзора литературы, результатов собственных исследований и их обсуждения, выводов, предложений для практики, списка литературы и приложения. В диссертации приведено 25 таблиц, 11 рисунков. Список литературы включает 230 источников, в том числе 76 иностранных авторов.


СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ

2.1. Материалы, методы и объемы исследований

Работу выполняли с 2007 по 2009 гг. в лаборатории функциональной диагностики болезней сельскохозяйственных животных ГНУ СКЗНИВИ Россельхозакадемии, Ростовской областной ветеринарной лаборатории, а также в хозяйствах Ростовской области.

При изучении распространения инфекционных и инвазионных заболеваний использовались отчетные данные ГУРО «Ростовская областная ветеринарная лаборатория». В работе использован комплексный эпизоотологический подход, включающий все современные методики эпизоотологических исследований согласно «Методическим указаниям по эпизоотологическому исследованию» (1987г.).

Эпизоотическую ситуацию по колибактериозу телят изучали в 3-х хозяйствах Ростовской области. Анализировали причины возникновения заболевания, клиническую картину и особенности его проявления в хозяйствах, изучали условия содержания телят, учитывали результаты ранее проводимого лечения, а так же эпизоотическую обстановку в регионе.

Клинический осмотр животных проводили по общепринятой схеме.

Для выявления тяжести течение колибактериоза использовали степень выраженности клинических и лабораторных признаков.

Кровь для биохимического и морфологического исследования брали из вены ушной раковины, а при ее плохой выраженности из яремной вены. В цельной крови определяли число эритроцитов и лейкоцитов путем подсчета в камере с сеткой Горяева, количество гемоглобина по методу Г.В. Дервиза и А.И. Воробьева в модификации Т.О. Григорьевой и Н.И. Капельсона (1972), цветовой показатель по А.А. Кудрявцеву с соавт. (1974), гематокрит в полистерольных трубках путем центрифугирования при 2500 об./мин. в течение 15 мин.

В сыворотке крови определяли активность аланинаминотрансферазы по методу Райтмана-Френкеля, общий билирубин по методу Йендрашика-Грофа, мочевину по реакции с диацетилмонооксимом в сильно кислой среде в присутствии тиосемикарбазида и ионов трехвалентного железа, глюкозы орто-толуидиновым методом, креатинина - фотометрическим способом. Объем циркулирующей крови определяли по методу Филипса.

Реографические исследования проводили с помощью компьютерного комплекса - реографа полианализатора для комплексного исследования параметров кровообращения РГПА 6/12 «РЕАН-ПОЛИ», программного обеспечения – версия 2, профессиональная для «РЕАН-ПОЛИ». Параметры системной гемодинамики определяли методом тетраполярной трансторакальной реокардиографии по Кубичеку.

Статистическую обработку результатов исследований проводили по Н.А. Плохинскому (1970), Хитоси Кумэ (1990) с использованием компьютерной техники AMD ATHLON.


2.2. Результаты исследования эпизоотологической ситуации

по болезням свиней в Ростовской области

Таблица 1

Заболеваемость свиней инфекционными болезнями в РО за 2006 - 2008 гг. (на 1000 гол.)

№ п/п

Болезни

2006 г.

2007 г.

2008 г.

1

цирковирусная инфекция

5,31

5,53

5,65

2

микоплазмоз

36,33

37,87

34,41

3

актинобац. плевропневмония

17,74

9,68

6,47

4

сальмонеллез

67,32

34,45

16,54

5

ТГС

17,78

14,01

11,56

6

колибактериоз

177,52

157,98

144,01

7

дизентерия

49,23

43,83

39,57

8

пастереллез

1,05

0,68

0,48

9

лептоспироз

0,39

0,41

0,42

10

ротавирусный энтерит

1,82

1,71

1,79

11

РРСС

13,21

11,28

10,67

12

гемофилезн. полисерозит

3,37

1,79

1,03

13

диплококкоз

27,69

29,93

25,43

14

хламидиоз

44,7

44,24

36,04

15

парвовирусная инфекция

10,88

10,27

9,6

16

болезнь Ауески

0,19

0,19

0,18

17

листериоз

0,81

0,68

0,63

18

рожа

90,95

88,48

96,77

19

стрептококкоз

21,81

19,79

16,92

20

классическая чума

2,6

2,28

2,08


Колибактериоз в 2006 г. отмечался в 21- м, в 2007 г. в 32-х, в 2008 г. в 39-и неблагополучных пунктах. Заболеваемость достигала максимума до 177,52 в 2006 г. (159,84 ± 16,83, Р < 0,5). Смертность в среднем за 3 года находилась на уровне 14,22 ±2,27 (Р <0,5). Летальность самая высокая отмечалась в 2006 г. и достигала 9,43 %, наименьшая в 2008 г. 8,54%, в среднем за 3 года была 8,87 ± 0,47% (Р< 0,25) (таблица 1).

Заболеваемость колибактериозом в 2006-2008 гг. снизилась с 177,52 до 144,01 на тыс. гол., при этом смертность за тот же промежуток времени сократилась с 16,73 до 12,3 на тыс. гол., а летальность с 9,43 до 8,54%. Среднемесячная заболеваемость в 2006/2008 годы, максимума достигала в декабре до 1,51±0,13, минимум отмечался в июле - 0,2 ± 0,18. Наибольшее число случаев заболевания регистрируется с декабря по май, таким образом, четко прослеживается сезонное проявление колибактериоза в зимне-весенний период года.

2.3. Оптимизация постановки диагноза на колибактериоз


Лабораторную диагностику колибактериоза поросят проводили согласно “Методическим указаниям по бактериологической диагностике колибактериоза (эшерихиоза) животных”, (2000г). Серологическую типизацию выделенных культур эшерихий проводили при помощи реакции агглютинации согласно “Методическим указаниям по бактериологической диагностике колибактериоза (эшерихиоза) животных”, (2000г). Типировали по О-антигену с набором поливалентных и серогрупповых О-колисывороток, а так же исследовали с агглютинирующими антиадгезивными сыворотками. Всего по серологической идентификации эшерихий было проведено 2309 исследований. В исследованных хозяйствах были выделены негемолитические штаммы E. coli серогрупп О26, О138 и О9.

Нами проведена апробация метода экспресс диагностики выявления серогрупп E. coli О26, О138 и О9 с помощью идентификации ДНК данных возбудителей методом ПЦР, для чего были использованы высокоспецифичных праймеры.

Нуклеотидные последовательности генов-мишеней для ПЦР были получены из баз данных NCBI GenBank. Анализ нуклеотидных полноразмерных геномов и участков генов, проводили с применением программы «BioEdit 6.0» и «Oligo 4.0».

В результате выравнивания нуклеотидных последовательностей tccP2-гена было выявлено несколько консервативных участков, которые и были избраны в качестве мишеней для отжига праймеров и проб. Дизайн праймеров, комплементарных данному участку осуществлялся таким образом, чтобы 3’-терминальные и/или субтерминальные нуклеотидные остатки были комплементарны видоспецифичным остаткам в последовательностях и содержали гуанин или цитозин.




Рисунок 1. Выравнивание последовательностей нуклеотидов tccP2-гена E.coli O26




Рисунок 2. Расположение амплификационого участка относительно последовательности гена tccP2 E.coli O26.


Для идентификации штаммов E. coli, принадлежащих к серологической группе O26 были подобраны специфические праймеры FO26 (5’–CCT AAC TGG CCT GCG CCA CC–3’) и RO26 (5’–GCA CCA GAC GCT GAG CCA CA–3’), фланкирующие участок генома в 227 н.п.

Аналогично был осуществлен дизайн праймеров для hlyA гена сероварианта О138 и espP гена сероварианта О9 (таблица 2).




Рисунок 3. Выравнивание последовательностей нуклеотидов hlyA-гена E.coli O138


Проверку на наличие в различных нуклеотидных последовательностях сайтов неспецифической гомологии для выбранных праймеров и зондов проводили с использованием поисковой системы BLAST (http://www.ncbi.nlm.nih.gov/blast/, NCBI, США).

В процессе оптимизации различных вариантов ПЦР подбирали температурный режим, число и продолжительность циклов амплификации, соотношение зондов и праймеров, концентрацию Мg+2, обеспечивающие максимальную чувствительность и специфичность обнаружения ДНК кишечной палочки.

Таблица 2

Структура праймеров для идентификации изолятов Е. coli

Праймер

Последовательность праймеров

Расчетная Тм отжига праймеров

Размер ампликона,

н.п.

FO26

5’–cctaactggcctgcgccacc–3’

68

227

RO26

5’–gcaccagacgctgagccaca–3’

66

FO9

5’–gaaacttatcgcattcagagc–3’

60

262

RO9

5’–ccatacagttccagcgacaa–3’

60

FO138

5’–accacgcgtgccgacaagtt–3’

64

321

RO138

5’–atctgccccctcactgccgt–3’

66


Для амплификации использовали однотипную программу, изменяя только температуру отжига праймеров для соответствующего сероварианта. Денатурация в течение 5-и минут при температуре 94ºС, далее 35 циклов, каждый из которых состоял из следующих этапов: 30 секунд –94ºС, 30 секунд – 68ºС, 30 секунд – 72ºС. В завершении программы 1 минута при 72ºС.

Детекцию ПЦР продукта проводили элеткрофорезом в агарозном геле с бромистым этидием под УФ светом с длиной волны 310 нм. По наличию специфического фрагмента амплификации определенного размера судили о присутствии ДНК соответствующего возбудителя в анализируемом материале.

2.4. Изучение морфологических и биохимических показателей крови у поросят при колибактериозе


Нами проведены морфологические исследования крови поросят, больных колибактериозом с различной клинической тяжестью течения заболевания (табл. 3).

Морфологические показатели крови характеризовались незначительным снижением числа эритроцитов при легком и среднем течении и выраженным снижением при тяжелом и крайне тяжелом течении колибактериоза, развитием лейкопении, тяжесть, которой соответствовала тяжести заболевания.

Таблица 3

Морфологические и биохимические показатели крови у поросят, больных колибактериозом

N п/п

Показатель

Ед. измерения

Здоровые животные

Тяжесть течения заболевания

Легкое

Среднее

Тяжелое

Очень тяжелое

1

Эритроциты

× 1012

5,8-8,4

5,8±1,44

6,03±1,56

4,96±1,48

4,08±1,37

2

Лейкоциты

× 109

8,5-10,5

8,5±1,1

5,32±1,02

4,38±1,39

2,01±1,41

3

Гемоглобин

г/л

120-180

120±12,4

128,28±32,4

100,51±26,9

96,45±28,2

4

Гематокрит




0,42-0,47

0,42±0,05

0,42±0,05

0,38±0,06

0,29±0,04

5

СОЭ

мм/ч

2,0-3,5

11,5±2,1

12,45±4,2

14,02±3,54

18,06±3,91

6

Общий белок

г/л

65-75

64±2,21

64,04±4,53

62,07±3,82

54,06±4,11

7

Альбумин

г/л

25-41

25±3,1

24,25±4,64

21,34±2,9

18,08±3,97

8

АлАТ

Е/л

25-50

66±4,32

79,03±14,82

96,45±16,43

126,54±17,7

9

Мочевина

ммоль/л

2,5-8,3

9,5±2,41

11,67±2,35

15,52±2,31

21,64±2,22

10

Креатинин

мкмоль/л

67-100

98±6,34

110,55±9,84

125,3±11,53

140,01±9,79

11

Билирубин

мкмоль/л

1,8-6,0

6,8±2,7

7,62±2,05

10,12±1,77

11,96±2,03

12

Глюкоза

ммоль/л

4,2-5,9

4,2±0,31

6,08±1,32

8,03±0,98

8,14±1,26

13

Амилаза

Е/л

840-1750

1750±45,3

1579,22±99,73

1854,3±83,1

2563,46±75,3

У поросят, больных колибактериозом, число лейкоцитов при легком течении заболевания оставалось в пределах нормы - 8,5±1,1×109/л, с развитием тяжелой панлейкопении при очень тяжелом течении - 2,01±1,41×109/л.


2.5. Результаты изучения иммунологического статуса у поросят при колибактериозе

Задачей этого этапа исследований явилось изучение особенностей клеточного и гуморального звеньев иммунитета у поросят при колибактериозе.

Нами проведены иммунологические исследования крови у поросят, тех же групп, которым проводили морфологические и биохимические исследования крови.

Результаты определения относительного и абсолютного содержания Т-лимфоцитов у поросят больных колибактериозом представлены в таблице 4.

Таблица 4

Показатели клеточного иммунитета периферической крови у поросят больных колибактериозом

Клиническое течение заболевания

Т - лимфоциты

Т-лимфоциты

Т-хелперы,

Т-супрессоры,

%

×109/л

%

×109/л

%

×109/л

легкое

44,77±0,48

2,5±0,09

27,52±0,94

0,68±0,1

11,85±0,6

0,3±0,02

средней тяжести

44,4±1,28*

1±0,03***

21,8±1,79*

0,23±0,02*

12,48±1,54

0,12±0,01*

тяжелое

32,16±1,5*

0,32±0,03*

17,1±1,12*

0,18±0,01*

9,1±0,85*

0,1±0,01**

очень тяжелое

26,2±1,63

0,19±0,03*

12,7±0,85*

0,04±0,02*

8±0,49**

0,02 ±1,2*

*p<0,05,** p <0,01,*** p <0,001 в сравнении с животными с легким течением колибактериоза.


Результаты определения относительного и абсолютного содержания В-лимфоцитов у больных колибактериозом представлены в таблице 4.

Установлено, что у поросят с легким течением колибактериоза число лейкоцитов периферической крови было 12,5×109г/л, процентное количество Т-лимфоцитов составило 46,3%, а абсолютное 2,45×109/л, Т-хелперов и Т- супрессоров соответственно 0,64×109/л и 0,29×109/л.

У поросят с клиническим течением средней тяжести отмечалась лейкопения до 9,8×109/л и лимфопения до 23,7×109/л. Что, кроме того, сопровождалось снижением процентного содержания Т-лимфоцитов до 44,32%, а абсолютного до 1,03×109/л, что на 1,42×109/л меньше, чем у поросят с легким течением колибактериоза. Процентное и абсолютное значение Т-хелперов и Т-супрессоров составило 21,72% и 0,22×109/л, 11,8% и 0,12×109/л соответственно, что на 0,42×109/л, 0,17×109/л меньше, чем у поросят с легким течением колибактериоза.

У поросят с тяжелым клиническим течением колибактериоза отмечалась лейкопения до 6,1×109/л и лимфопения до 16,9×109/л. Лимфопения сопровождалась снижением процентного содержания Т-лимфоцитов до 31,3 %, а абсолютного – до 0,32×109/л, что на 2,13×109/л меньше, чем у поросят с легким течением колибактериоза. Процентное и абсолютное значение Т-хелперов и Т-супрессоров составило 16,72% и 0,17×109/л, 9,31% и 0,1×109/л соответственно, что на 0,47×109/л и 0,19×109/л меньше, чем у поросят с легким течением колибактериоза.

У поросят с очень тяжелым клиническим течением колибактериоза отмечалась лейкопения до 5,8×109/л и лимфопения до 13,7×109/л. Лимфопения сопровождалась снижением процентного содержания Т-лимфоцитов до 26,24%, а абсолютного – до 0,21×109/л, что на 2,24×109/л меньше, чем у поросят с легким течением колибактериоза. Процентное и абсолютное значение Т-хелперов и Т-супрессоров составило 12,51% и 0,03×109/л, 8,52% и 0,02×109/л соответственно, что на 0,61×109/л и 0,27×109/л меньше, чем у поросят с легким течением колибактериоза.

Все эти изменения: снижение общего числа Т-лимфоцитов и отдельных популяций РОК, снижение их соотношения (р-РОК и в-РОК), по всей видимости, отражают перераспределение клеток и нарушение лимфопоэза у поросят с колибактериозом и изменение регуляторного потенциала лимфоидных тканей.

Таблица 5

Показатели гуморального иммунитета у поросят больных колибактериозом

Группа,

(n = 20)

В-лимфоциты

Иммуноглобулины

%

×109/л

А, мг/мл

G, мг/мл

М, мг/мл

легкое

22,94±2,11

1,29±0,04

4,2±0,11

14,2±0,21

1,37±0,022

средней тяжести

22,2±0,3

0,5±0,05

3,46±0,03

13,89±0,11

1,23±0,21

тяжелое

14,6±2,2**

0,14±0,06*

2,2±0,11*

13±0,03

1,14±0,22

очень тяжелое

12,06±0,16*

0,09±0,31*

2,1±0,1

11,5±0,23

1±0,03

*p<0,05,** p <0,01 в сравнении с животными с легким течением колибактериоза.

Анализ показателей, характеризующих гуморальное звено иммунитета у поросят больных колибактериозом, выявил, что относительное содержание в крови В-лимфоцитов у поросят у поросят с легким клиническим течением колибактериоза составил 23,8%, а в абсолютном значении 1,29±0,04×109/л, средний уровень иммуноглобулина А, G и М составил соответственно 4,21 мг/мл; 15,2 мг/мл; 1,37 мг/мл.

У поросят с клиническим течением колибактериоза средней тяжести процентное количество В-лимфоцитов периферической крови снизилось до 22,14%, но, учитывая лейкопению и лимфопению, абсолютное значение В-лимфоцитов снизилось до 0,5±0,05×109/л, что на 59,5% ниже, чем у поросят с легким течением колибактериоза. Средний уровень иммуноглобилина А, G и М составил соответственно 3,58 мг/мл; 14,7 мг/мл; 1,28 мг/мл, что на 15; 3,3 и 6,6% ниже, чем у поросят с легким течением колибактериоза.

У поросят с тяжелым клиническим течением колибактериоза процентное количество В-лимфоцитов периферической крови снизилось до 14,37%, но, учитывая лейкопению и лимфопению, абсолютное значение В-лимфоцитов оказалось 0,14±0,06×109/л, что на 88,1% ниже, чем у поросят с легким течением колибактериоза. Средний уровень иммуноглобулина А, G и М составил соответственно 2,17 мг/мл; 12,4 мг/мл; 1,14 мг/мл, что на 48,5, 18,4 и 16,8 % ниже, чем у поросят с легким течением колибактериоза.

У поросят с очень тяжелым клиническим течением колибактериоза процентное количество В-лимфоцитов периферической крови снизилось до 11,72%, но, учитывая лейкопению и лимфопению, абсолютное значение В-лимфоцитов оказалось 0,09±0,31×109/л, что на 93% ниже, чем у поросят с легким течением колибактериоза. Средний уровень иммуноглобулина А, G и М составил соответственно 1,98 мг/мл; 11,7 мг/мл; 1,05 мг/мл, что на 47,03, 23,3 и 23,4% ниже, чем у поросят с легким течением колибактериоза.

2.6. Клинические, электрокардиографические и реографические признаки колибактериоза поросят


Изучая клиническое течение колибактериоза у поросят мы установили, что энтеротоксическая форма колибактериоза, вызываемая энтреротоксигенными штаммами E. coli может иметь легкое, среднее, тяжелое и очень тяжелое клиническое течение заболевания.

По развитию изменений со стороны сердечнососудистой системы установили 4 формы колибактериоза: протекающий с простым обезвоживанием, вазотоксическая форма, кардиодепрессивная форма, смешанная форма.

Колибактериоз протекающий с простым обезвоживанием. Основой постановки диагноза на колибактериоз, протекающий с простым обезвоживанием, является выявление во время реографического исследования низкого или нормального МОК, снижение УО и КДДЛЖ при одновременно высоких показателях ОПСС. Колибактериоз, протекающий с простым обезвоживанием, может протекать с любой тяжестью течения заболевания, необходимо только отметить, что при тяжелом и крайне тяжелом течении заболевания он всегда переходит в смешанную форму, то есть присоединяется или вазотоксическая или кардиодепрессивная форма. В чистом виде при тяжелом течении заболевания эта форма никогда не встречается. Для нее наиболее характерно субклиническое, легкое и среднее течение заболевания.

При клиническом осмотре регистрируются чаще всего угнетение, понос, отказ от корма и воды. Частота встречаемости клинических признаков при данной форме заболевания представлены в таблице 6.

При легком течении температура тела оставалась нормальной, при средней тяжести течения заболевания встречали в 83%, и при тяжелом течении в 100% случаев. Понос регистрировались у 75-85% заболевших этой формой колибактериоза. Каловые массы при этом разжижены, зачастую зеленоватого цвета, иногда пенистые. При длительном течении заболевания и развитии секреторной диареи каловые массы становятся водянистыми. У половины заболевших поросят наблюдалась астения, а при среднем течении заболевания она в той или иной степени выявлялась у 80% животных.

Таблица 6

Клинические признаки при колибактериозе поросят с простым обезвоживанием %.

Симптомы

Клиническое течение заболевания

Легкое

Среднее

Тяжелое

Астения

-

50

80

Температура тела, повышение

-

83

100

Обезвоживание

20

80

100

Диарея

20

85

87

Болезненность живота

10

40

84

Бледность слизистых

-

40

50

Тахикардия

-

10

15

Слабое наполнение пульса

-

32

42

Увеличение скорости наполнения капилляров

-

-

45

Изменение тонов сердца

-

-

-

Атония кишечника

-

10

15

Парез кишечника

-

-

-

Такие признаки расстройства работы сердечнососудистой системы, как бледность слизистых, тахикардия, слабое наполнение пульса, увеличение скорости наполнения капилляров, изменение тонов сердца - характерны для кардиодепрессивной формы. При заболевании средней тяжести отмечали ослабление наполнения пульса у 42% животных, тахикардия у 15% и увеличение скорости наполнения капилляров у 45% животных. Признаки атонии кишечника отмечались у 10-15% поросят, а пареза кишечника, характерного для вазотоксической формы колибактериоза не отмечали.

Вазотоксическая форма колибактериоза. Основой постановки диагноза на вазотоксическую форму колибактериоза, является выявление во время реографического исследования высокого МОК при одновременно низких показателях КДДЛЖ и ОПСС. Клинической основой постановки диагноза является парез кишечника. Эта форма протекает со средним, тяжелым и очень тяжелым клиническим течением заболевания. Частота встречаемости клинических признаков при этой форме показана в таблице 7.

Температура тела повышенная в начале заболевания, по мере усложнения процесса снижалась и при тяжелом и очень тяжелом течении в 50-80% случаев была ниже нормальных показателей.

Болезненность живота при пальпации выявлялась во всех случаях.

Таблица 7

Клинические признаки при вазотоксической форме колибактериоза поросят %

Симптомы

Клиническое течения заболевания

Средней тяжести

Тяжелое

Очень тяжелое

Астения

80

100

100

Рвота

90

100

100

Температура тела, повышение

80

45

20

Температура тела, снижение

20

55

80

Обезвоживание

80

80

100

Диарея

20

10

20

Болезненность живота

10

100

100

Бледность слизистых

85

100

100

Тахикардия

100

100

100

Слабое наполнение пульса

100

100

100

Увеличение скорости наполнения капилляров

100

100

100

Изменение тонов сердца

-

15

45

Атония кишечника

55

100

100

Парез кишечника

-

100

100

Таблица 8

Клинические признаки при кардиодепрессивной форме колибактериоза поросят %.

Симптомы

Тяжелое течение

Очень тяжелое течение

Астения

100

100

Рвота

100

100

Температура тела, повышение

10

20

Температура тела, снижение

80

90

Обезвоживание

81,3

100

Диарея

45

50

Зияние ануса

61

100

Болезненность живота

100

100

Бледность слизистых

100

100

Тахикардия

100

100

Слабое наполнение пульса

100

100

Увеличение скорости наполнения капилляров

100

100

Изменение тонов сердца

100

100

Атония кишечника

90

44

Парез кишечника

10

56

Признаки расстройства работы сердечнососудистой системы: бледность слизистых, тахикардия, слабое наполнение пульса, увеличение скорости наполнения капилляров, выявляли во всех случаях, так как вазотоксическая форма сопровождается серьезными расстройствами со стороны ССС. Только изменения тонов сердца встречается всего в 15-45% случаев. Если рвоту выявляли у всех поросят, то у 80% животных отмечали задержку стула вследствие пареза толстого отдела ЖКТ. Если после надплевральной блокады удавалось добиться отхождения кала, то он всегда был с кровью и зловонным. На наш взгляд именно задержка стула вследствие пареза кишечника является основой развития септического синдрома при колибактериозе. Во-первых, происходит повреждение кишечного барьера возбудителем, во-вторых, происходит массовое размножение анаэробных бактерий вследствие снижения местного иммунитета, и, в-третьих, невозможность вывести токсины бактерий вследствие задержки стула приводит к быстрому дополнительному повреждению барьера и транспозиции бактерий через стенку кишечника. Поэтому неотложной задачей при этой форме колибактериоза следует считать: обеспечение эвакуации содержимого ЖКТ, что легче всего добиться новокаиновой блокадой. Задержка стула более чем на 4 часа при колибактериозе является основным клиническим проявлением вазотоксической формы болезни.

Кардиодепрессивная форма колибактериоза. Основой постановки диагноза на кардиодепрессивную форму колибактериоза, является выявление во время реографического исследования низкого МОК и УО, при одновременно высоком КДДЛЖ и ОПСС.

Клинической основой постановки диагноза является хорошее наполнение вен и аускультативные изменения работы сердца, а также резко выраженная астения.

Наиболее часто встречаемые признаки при кардиодепрессивной форме у поросят больных колибактериозом указаны в таблице 8.

Из таблицы видно, что кардиодепрессивная форма протекает с тяжелым и очень тяжелым течением болезни. Признаки расстройства работы сердечнососудистой системы: бледность слизистых, тахикардия, слабое наполнение пульса, увеличение скорости наполнения капилляров, выявлялись во всех случаях, также как и изменения тонов сердца.

2.7. Реографические исследования у поросят, больных колибактериозом


Нами впервые в ветеринарной практике было проведено исследование системной гемодинамики по Кубичеку поросят, больных колибактериозом, с расчетом основных показателей гемодинамического профиля.

По развитию изменений со стороны сердечнососудистой системы мы выделили 4 клинико-морфологические формы колибактериоза: протекающий с простым обезвоживанием, вазотоксическая форма, кардиодепрессивная форма, смешанная форма.

Таблица 9

Частота встречаемости различных клинико-морфологических форм колибактериоза с различной тяжестью течения

Форма заболевания

Степень тяжести заболевания

Легкая

Средняя

Тяжелая

Очень тяжелая

Простое обезвоживание

178

117

32

-

Вазотоксическая

-

-

66

41

Кардиодепрессивная

-

-

41

28

Смешанная

-

43

103

31


Таким образом, нами выявлено 11 типов клинического течения колибактериоза: колибактериоз с простым обезвоживанием легкой, средней и тяжелой степенью течения, вазотоксическая форма колибактериоза с тяжелым и очень тяжелым течением заболевания, кардиодепрессивная форма с тяжелым и очень тяжелым течением заболевания и смешанная форма с заболеванием средней, тяжелой и очень тяжелой степенью.

Колибактериоз с простым обезвоживанием, протекающий с легким течением заболевания, характеризуется практически нормальными показателями артериального давления и сердечного выброса. Ударный индекс и КДДЛЖ снижаются на 8 и 19,4% соответственно. В таких условиях поддержание САД и СИ достигается это за счет увеличения ЧСС на 16% и одновременным увеличением УПСС на 5%. Таким образом, даже при легком течении заболевания отмечается тенденция к снижению УПСС и КДДЛЖ при высоком УПСС, что и давало основание поставить диагноз обезвоживание. По мере нарастания обезвоживания увеличение ЧСС не компенсировало СИ и начинало падать системное давление, так при средней тяжести течения заболевания оно было снижено на 9% и при тяжелом течении уже на 42%, при этом, для того, что бы поддержать циркуляцию крови в жизненно важных органах, происходило рефлекторное увеличение УПСС, которое при тяжелом течении заболевания повышалось почти вдвое, тогда как сердечный индекс падал на 45%, а КДДЛЖ на 65%.

Легкая форма обезвоживания сопровождается снижением КДДЛЖ и увеличением УПСС при нормальном системном давлении и СИ; тяжелая форма обезвоживания характеризуется резким падением СИ на 40% и более на фоне сниженного КДДЛЖ на 40% и более и резкого повышения УПСС на 60%.

Вазотоксическая форма колибактериоза нами диагностирована только при тяжелом и очень тяжелом течении заболевания, при этом для тяжелого течения оказалось характерным увеличение СИ на 124%, тогда как при очень тяжелом течении СИ оказался в пределах норма. Увеличение сердечного индекса происходило в первую очередь за счет резкого увеличения ЧСС, на 217 и 282% соответственно, способствовало этому и снижение УПСС на 51 и 16,5 %, КДДЛЖ прогрессивно снижалось при легком течении за счет снижения УПСС, так как уменьшался возврат крови в сердце, а при очень тяжелом течении, больше за счет снижения УИ, при этом УПСС имело тенденцию к нарастанию. Таким образом, несмотря на вазоплегию при сепсисе по мере утяжеления заболевания все-таки включаются компенсаторные механизмы, поддержать системное давление они не могут и оно прогрессивно снижается на 34 и 57%.

Вазотоксическая форма колибактериоза характеризуется снижением КДДЛЖ до 40%, снижением УПСС до 50%, и нормальным КДДЛЖ.

Кардиодепрессивная форма протекала как и вазотоксическая с тяжелым и очень тяжелым течением заболевания. Мало того если не удается купировать тяжелую форму колибактериоза с обезвоживанием или вазотоксическую форму они всегда переходят в кардиодепрессивную, при которой резко снижается сердечный индекс и растет КДДЛЖ.

Кардиодепрессивная форма характеризовалась резким снижением САД (более чем на 50%), за счет как снижения СИ, так и УИ (более чем на 40%), при этом возврат крови в сердце происходит нормально (КДДЛЖ растет до значительных величин- 25 мм.рт.ст.), но преднагрузка (кровь поступившая в сердце) не реализуется ослабленным миокардом (снижение СИ, УИ). При этом развивается выраженная тахикардия, не компенсирующая снижение СИ. ССС на значительное снижение САД реагирует увеличением УПСС.

Кардиодепрессивная форма колибактериоза характеризуется подъемом КДДЛЖ выше 20 мм.рт.ст., снижением СИ и УИ на 40% и более, при увеличенном УПСС до 40%.

2.8. Сравнительное изучение методов диагностики и схем

лечения поросят при колибактериозе


Нами апробировано три схемы лечения поросят больных колибактериозом.

Схема 1. Внутримышечно Драксин (2,5 мг тулатромицина на 1 кг массы животного) в дозе 0,1 мл на 4,0 кг массы однократно; подкожно, изотонический раствор натрия хлорида в дозе 20 мл на 1,0 кг веса животного в течение суток.

Схема 2. Внутримышечно Драксин (2,5 мг тулатромицина на 1 кг массы животного) в дозе 0,1 мл на 4,0 кг массы однократно, подкожно, изотонический раствор натрия хлорида в дозе 5 мл на 1,0 кг веса животного в течение суток; кофеин-бензоат натрия 0,01 мл 10% раствора (1,0 мг) на 1,0 кг веса животного три раза в день.

Схема 3. Внутримышечно Драксин (2,5 мг тулатромицина на 1 кг массы животного) в дозе 0,1 мл на 4,0 кг массы однократно; подкожно, изотонический раствор натрия хлорида в дозе 5 мл на 1,0 кг веса животного в течение суток; кофеин-бензоат натрия 0,01 мл 10% раствора (1,0 мг) на 1,0 кг веса животного три раза в день; подкожно изадрин (в виде 1%-ного раствора в ампулах по 1 мл) по 0,01 мл (0,1 мг) на 10 кг массы тела 3 раза в день.

Сыворотка поливалентная против колибактериоза (эшерихиоза) сельскохозяйственных животных (Витебская биофабрика) 20,0 в 2-3 приема с интервалом в 3 часа всем животным.

В процессе опытов установлено, что для лечения животных больных колибактериозом с простым обезвоживанием необходимо применять схему один, животным больным вазотоксической формой колибактериоза необходимо применять схему два, а поросят с кардиодепрессивной формой колибактериоза лечить по схеме три.


4. ВЫВОДЫ

  1. В нозологической структуре болезней поросят в условиях Ростовской области, доля колибактериоза составила 21% от патологии желудочно-кишечного тракта и 6,2% от общей патологии поросят. Заболеваемость колибактериозом в 2006-2008 гг. снизилась с 177,52 до 144,01 на тыс. гол., при этом смертность за тот же промежуток времени сократилась с 16,73 до 12,3 на тыс. гол., а летальность с 9,43 до 8,54%. Среднемесячная заболеваемость в 2006/2008 годы, максимума достигала в декабре до 1,51±0,13, минимум отмечался в июле - 0,2 ± 0,18. Наибольшее число случаев заболевания регистрируется с декабря по май, таким образом, четко прослеживается сезонное проявление колибактериоза в зимне-весенний период года.

  2. Для экспресс диагностики колибактериоза вызванного E. coli серогрупп О26, О138 и О9 положительно зарекомендовало использование идентификации ДНК методом ПЦР.

  3. Морфологические показатели крови характеризовались незначительным снижением числа эритроцитов при легком и среднем течении и выраженным снижением при тяжелом и крайне тяжелом течении колибактериоза, развитием лейкопении, тяжесть, которой соответствовала тяжести заболевания. У поросят, больных колибактериозом, число лейкоцитов при легком течении заболевания оставалось в пределах нормы - 8,5±1,1×109/л, с развитием тяжелой панлейкопении при очень тяжелом течении - 2,01±1,41×109/л. У поросят с тяжелым течением колибактериоза отмечалась лейкопения до 5,8×109/л и лимфопения до 13,7×109/л. Лимфопения сопровождалась снижением процентного содержания Т-лимфоцитов до 26,24%, а абсолютного – до 0,21×109/л, что на 2,24×109/л меньше, чем у поросят с легким течением колибактериоза. Процентное и абсолютное значение Т-хелперов и Т-супрессоров составило 12,51% и 0,03×109/л, 8,52% и 0,02×109/л соответственно, что на 0,61×109/л и 0,27×109/л меньше, чем у здоровых животных. У поросят с тяжелым течением колибактериоза количество В-лимфоцитов в периферической крови снизилось до 11,72%, но, учитывая лейкопению и лимфопению, абсолютное значение В-лимфоцитов оказалось 0,09±0,31×109/л, что на 93% ниже, чем у поросят с легким течением колибактериоза. Средний уровень иммуноглобулина А, G и М составил соответственно 1,98 мг/мл; 11,7 мг/мл; 1,05 мг/мл, что на 47,03, 23,3 и 23,4% ниже, чем у поросят с легким течением колибактериоза.

  4. По развитию изменений со стороны сердечнососудистой системы выделили 4 типа колибактериоза: протекающего с простым обезвоживанием, вазотоксический тип колибактериоза, кардиодепрессивный тип колибактериоза, смешанный тип. Каждый из этих типов может протекать с разной степенью тяжести, формируя 11 подтипов клинического течения колибактериоза.

  5. Основой постановки диагноза на колибактериоз, протекающий с простым обезвоживанием, является выявление во время реографического исследования низкого или нормального МОК, снижение УО и КДДЛЖ при одновременно высоких показателях ОПСС.

Основой постановки диагноза на септический тип колибактериоза, является выявление во время реографического исследования высокого МОК при одновременно низких показателях КДДЛЖ и ОПСС. Клинической основой постановки диагноза является парез кишечника.

Основой постановки диагноза на кардиодепрессивный тип колибактериоза, является выявление во время реографического исследования низкого МОК и УО, при одновременно высоком КДДЛЖ и ОПСС. Клинической основой постановки диагноза является хорошее наполнение вен и аускультативные изменения работы сердца, а также резко выраженная астения, вплоть до полной атонии животного.

  1. Для лечения поросят больных колибактериозом рекомендуем 3 схемы. Каждая схема лечения разработана для соответствующей формы заболевания. У животных больных колибактериозом с простым обезвоживанием улучшение морфологических и биохимических показателей крови происходит при применении схемы лечения №1, дальнейшее форсирование терапевтических мероприятий не ускоряет выздоровление животных.

5. ПРАКТИЧЕСКИЕ ПРЕДЛОЖЕНИЯ

1. Для экспресс диагностики колибактериоза вызванного E. coli серогрупп О26, О138 и О9 превалирующих в Ростовской области использовать метод ПЦР-диагностики.

2. Для диагностики типа колибактериоза поросят, непосредственного контроля за состоянием витальных функций организма в процессе лечения, предлагаем использовать метод реокардиографии – интегральную реокардиограмму по Кубечеку.

3. Для лечения животных больных колибактериозом с кардиодепрессивным типом необходимо этиотропную терапию сочетать с применением Драксин в дозе 0,1 мл на 4,0 кг массы однократно подкожно; подкожно, изотонический раствор натрия хлорида в дозе 5 мл на 1,0 кг веса животного в течение суток; кофеин-бензоат натрия 0,01 мл 10% раствора (1,0 мг) на 1,0 кг веса животного три раза в день; подкожно изадрин по 0,01 мл (0,1 мг) на 10 кг массы тела 3 раза в день.


Список работ, опубликованных по тематике диссертации:

  1. Астахова Д.А. Повышение эффективности инфузионной терапии при заболеваниях желудочно-кишечного тракта /Астахова Д.А.// Актуальные проблемы патологии морфологии и онкологии животных. Материалы Всероссийской научно-практической конференции. 2007г. – Новочеркасск. – С. 172-173.

  2. Астахова Д.А. Особенности течения токсической диспепсии поросят в зависимости от состояния сердечно-сосудистой системы. /Астахова Д.А.// Актуальные проблемы патологии морфологии и онкологии животных. Материалы Всероссийской научно-практической конференции. 2007г. – Новочеркасск. – С. 175-180.

  3. Бутенков А.И. Изменения центральной гемодинамики у поросят, больных гастроэнтеритом сопровождающимся кровотечением. /Бутенков А.И., Астахова Д.А.// Ветеринарная медицина. Современные проблемы и перспективы развития: Материалы VIII Всероссийской научно-практической конференции 2008г. – Саратов. – С. 84-86.

  4. Астахова Д.А. Оптимизация энергетического метаболизма у поросят больных тяжелым гастроэнтеритом. /Астахова Д.А., Бутенков А.И.// Ветеринарная медицина. Современные проблемы и перспективы развития: Материалы VIII Всероссийской научно-практической конференции 2008г. – Саратов. – С. 86-90.

  5. Астахова Д.А. Результаты изучения иммунологического статуса у поросят с гипотрофией разной степени тяжести. /Астахова Д.А., Бутенков А.И., Половинка В.В., Карташов С.Н.// Роль биологии и ветеринарной медицины в реализации государственной программы развития сельского хозяйства на 2008-2012гг.: материалы международной научно-практической конференции 2008г. - Оренбург. – С. 12-15.

  6. Бутенков А.И. Состояние биоценоза кишечника у поросят, переболевших колибактериозом. /Бутенков А.И., Астахова Д.А., Карташов С.Н., Миронова О.А.// Современное состояние и перспективы развития патологии, морфологии и онкологии животных: Материалы Всероссийской научно-практической конференции 2008г. - Новочеркасск. – С. 48-50.

  7. Бутенков А.И. Эффективность адсорбентов при лечении поросят больных колибактериозом. /Бутенков А.И., Астахова Д.А., Карташов С.Н.// Современное состояние и перспективы развития патологии, морфологии и онкологии животных: Материалы Всероссийской научно-практической конференции 2008г. - Новочеркасск. – С. 51-52. Бутенков А.И., Карташов С.Н.

  8. Астахова Д.А. Обезвоживание – причина сердечной дисфункции у поросят. /Астахова Д.А.// Проблемы, задачи и пути научного обеспечения приоритетного национально проекта «Развитие АПК»: Материалы Всероссийской научно-практической конференции. май 2008г., г. Новочеркасск, ГНУ СКЗНИВИ Россельхозакадемии. – С. 146-149.

  9. Бутенков А.И. Специфика изменений клеточной системы иммунитета у поросят в разном физическом состоянии. /Бутенков А.И., Астахова Д.А., Николаенко В.Н., Владыкин М.С.// Труды Кубанского государственного аграрного университета. Научный журнал Серия «Ветеринарные науки» № 1(ч.2) 2009 г. – С. 245-249.

  10. Бутенков А.И. Особенности гуморального иммунитета у поросят при различном физиологическом состоянии. /Бутенков А.И., Владыкин М.С., Астахова Д.А., Николаенко В.Н., // Труды Кубанского государственного аграрного университета. Научный журнал Серия «Ветеринарные науки» № 1(ч.2) 2009 г. – С. 253-256.



Добавить документ в свой блог или на сайт
Ваша оценка этого документа будет первой.
Ваша оценка:

Похожие:

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconФармакологическое обоснование применения тетраголда при колибактериозе поросят 06. 02. 03 ветеринарная фармакология и токсикология 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconЛечебно профилактическая эффективность пробиотика лаксубтил при колибактериозе телят 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconАнтимикробная активность и лечебная эффективность комплексного препарата диоксинор при респираторных болезнях поросят 16. 00. 03 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconАнтимикробная активность и лечебная эффективность тилоколина при бактериальных инфекциях органов дыхания поросят 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconИммунный статус поросят при пневмонии, вызванной вирусом репродуктивно-респираторного синдрома свиней 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconПрофилактика и лечение колибактериоза (отечной болезни) и сальмонеллеза поросят с использованием иммунометаболических средств 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconЭпизоотологический надзор и контроль при зоонозах в поволжском регионе 16. 00. 03 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconВлияние гликопина на иммуногенез у животных при комплексном применении с вакцинами 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология icon16. 00. 03 -ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Гемодинамические расстройства у поросят при колибактериозе и их коррекция 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология iconТерапевтическая эффективность гинодиксина при эндометритах и маститах у коров, вызванных условно-патогенной микрофлорой 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология 06.

Поместите кнопку у себя на сайте:
Образование


База данных защищена авторским правом ©cow-leech 2000-2013
обратиться к администрации | правообладателям | пользователям
COW-LEECH.RU