Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота icon

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота





Скачать 310.89 Kb.
НазваниеУдк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота
Дата конвертации31.05.2013
Размер310.89 Kb.
ТипДокументы
УДК 619: 616-07


Метод выделения ДНК и тест-система ПЦР в реальном времени для диагностики лейкоза крупного рогатого скота


Е.Б. Евтыхова1, К.Н. Мукантаев1, К. Турсунов1, И.И. Сытник2, Т.Б. Карибаев2,

Б.Б. Хасенов1, А.В. Шустов1


1 РГП «Национальный центр биотехнологии Республики Казахстан», г. Астана

2 Национальный референтный центр по ветеринарии, г. Астана


e-mail: lenayev26@gmail.com


Энзоотический лейкоз КРС – инфекционная болезнь крупного рогатого скота, которая в последние десятилетия удерживает первое место по распространённости среди продуктивного поголовья как в развитых, так и в развивающихся странах, включая Казахстан. По данным ветеринарной службы РК, в настоящее время встречаемость маркёров лейкоза среди поголовья растёт, что требует усиления профилактических мероприятий, а также улучшения обеспеченности хозяйств средствами диагностики, использующими рекомендованные методы – AGID (метод иммунодиффузии в агарозном геле), ИФА и ПЦР. Такие тест-системы на отечественном рынке либо импортные, либо укомплектованы в Казахстане из импортируемых компонентов. Актуально создание прототипов тест-систем для ветеринарии из компонентов, производимых на отечественной технологической базе.

В статье описан метод выделения ДНК из крови коров, пригодной для исследования в диагностической ПЦР. Приведены химические составы и протоколы приготовления всех компонентов лабораторного прототипа набора для выделения ДНК из крови.

Разрабатывали тест-систему ПЦР с индикацией результатов в реальном времени (ПЦР-РВ) для диагностики инфекции вирусом лейкоза КРС. В статье описаны последовательности праймеров и зондов и оптимальные реакционные условия ПЦР-РВ. Лабораторный прототип тест-системы ПЦР-РВ выявляет интегрированный провирус, присутствующий в ДНК инфицированных животных и, для удобства контроля качества выполнения теста, имеет внутренний контроль амплификации, нацеленный на последовательность из генома крупного рогатого скота. Исследование панели образцов (n=112) от взрослых коров из племенного хозяйства выявило совпадение результатов ИФА и ПЦР-РВ для 89% проб, причём, принимая ИФА в коммерчески доступной тест-системе в качестве «золотого стандарта», чувствительность и специфичность ПЦР-РВ составили 80 и 100% соответственно.

Ключевые слова: вирус лейкоза, эпизоотический надзор, выделение ДНК, тест-система, ПЦР реального времени, иммуноферментный анализ.


Введение


Энзоотический лейкоз крупного рогатого скота (ЛКРС) - контагиозная болезнь взрослого скота, патогенез которой обусловлен злокачественной (опухолевой) трансформацией B-лимфоцитов. ЛКРС разнообразен по клиническим формам, которые включают: бессимптомное носительство, субклиническое течение с персистирующим лимфоцитозом или системным гемобластозом – лейкемией. Инкубационный период болезни длится до 4-5 лет, у инфицированных телят симптомы не появляются как минимум до 2-летнего возраста. Болезнь носит хронический характер, не излечима. Клинически выраженный ЛКРС существенно снижает продуктивность скота. У 5-10% инфицированных животных болезнь заканчивается тяжёлыми поражениями внутренних органов, что приводит к падежу или вынужденному убою. У таких животных в селезёнке, лимфоузлах и скоплениях лимфоидной ткани в слизистых оболочках выявляются плотно упакованные мономорфные лимфоциты, причём для пораженных мест характерно наличие глубоких язв. Неблагополучные по лейкозу хозяйства несут значительный экономический ущерб из-за вынужденного убоя, затрат на противоэпизоотические мероприятия и оздоровление поголовья (в случае тяжёлой поражённости требуется полная замена поголовья), ограничений на торговлю скотом и перемещение животных, затрат на дополнительную обработку продукции (молоко от лейкозных коров по действующим правилам подлежит обязательной пастеризации). Инфицированный скот подлежит выводу из племенной работы, и по этой причине хозяйства, содержащие высокопродуктивный племенной скот, подвергаются особенно большому экономическому риску. Лейкоз КРС является препятствием для международной торговли - многие страны (в том числе имеющие высокие уровни поражённости стад энзоотическим лейкозом) запрещают ввоз животных, имеющих маркёры данной инфекции.

Энзоотический (инфекционный) лейкоз КРС вызывается вирусом лейкоза КРС (ВЛКРС). ВЛКРС - представитель рода Deltaretrovirus семейства Retroviridae, который, кроме ВЛКРС, включает вирусы приматов: вирус Т-клеточного лейкоза человека (типов 1 и 2) и вирус Т-клеточного лейкоза обезьян. Род дельтаретровирусов включает горизонтально передаваемые лимфотропные РНК, содержащие вирусы, жизненный цикл которых предусматривает обязательную интеграцию ДНК-копии вирусного генома в геном инфицированной клетки. Онкогенность указанных вирусов связывают с наличием в их геномах регуляторных генов (Tax и Rex).

У больных животных возбудитель ЛКРС выявляют преимущественно в форме, связанной с лимфоцитами; титры внеклеточного ВЛКРС в сыворотке крови и молоке больных коров невелики. Для распространения инфекции наибольшее значение имеет горизонтальная передача, опосредованная биологическими жидкостями, содержащими живые инфицированные лимфоциты. Для заражения коровы достаточно ввести внутрикожно 2500 лимфоцитов [1].

Парентеральные манипуляции (вакцинации, инъекции антибиотиков, обезроживание телят и др.), если они проводятся без соответствующих мер предосторожности, создают высокий риск заражения. Телята заражаются при вскармливании непастеризованным молоком от инфицированных коров. Считается возможной передача инфекции при тесных физических контактах между животными, которая, вероятно, происходит при частом попадании экссудатов (слюна, носоглоточные выделения) от больного животного на здоровое. Вертикальную передачу ВЛКРС (от матери потомству до или непосредственно во время рождения) наблюдают у 4-8% телят, рожденных от инфицированных коров.

В настоящее время энзоотический лейкоз КРС распространён на всех континентах и во всех странах мира. Как правило, источником вспышки ЛКРС являются инфицированные животные из числа привозного скота из Европы. В странах бывшего СССР возникновение проблемы лейкоза КРС связано с завозом племенного скота в 30-е и в послевоенные годы.

Средств специфической терапии инфекции ВЛКРС нет. Для профилактики лейкоза предложен ряд вакцин на основе инактивированного вируса. В условиях ограниченных испытаний in vivo такие вакцины оказались эффективными, но применения в практике животноводства пока не получили [2]. На сегодняшний день наиболее эффективными методами борьбы с лейкозом являются его ранняя диагностика, изоляция и скорейший вывод из хозяйственного использования больных животных.

Встречаемость маркёров инфекции ВЛКРС чрезвычайно варьирует между разными стадами и хозяйствами даже в пределах одной страны (например, в США показатель поражённости стад варьирует от 0 до 100%) [2].

Относительно эпизоотологической ситуации по ЛКРС в Казахстане известно, что данная болезнь регистрируется во всех областях республики, но наибольшее распространение получила в Северном Казахстане. Опубликованы данные Республиканской ветлаборатории, согласно которым в 2001 г. положительными по маркёрам инфекции ВЛКРС были 11,8% от числа обследованных животных, в 2002 г., - 6,6%, в 2003 г. - 5,6%, в 2004 г. - 9,9%, в 2005 г. - 10,0% и в 2006 г. - 6,9% [3]. По другим данным, уровень инфицирования КРС в Казахстане вирусом лейкоза составляет от 10 до 50% от общего поголовья скота [4]. В одной Акмолинской области за период 2004-2009 гг. обследовали 202629 голов КРС; из них лейкоз выявлен у 10,7% [4]. По данным СМИ, за 2010-2011 гг. в некоторых племенных хозяйствах Казахстана уровень серопозитивности скота на маркёры энзоотического лейкоза достиг 45%. В соседней России ЛКРС также широко распространён, и в структуре заболеваемости скота занимает лидирующее место (на долю ЛКРС приходится 57% случаев от всех регистрируемых нозологий [5].

Многие параметры эпизоотии ЛКРС в Казахстане не изучены. Все доступные данные за разные годы получены в ходе выборочных исследований; численность ежегодно обследуемого поголовья варьирует в зависимости от годового плана ветеринарных мероприятий. Регулярного тотального обследования на лейкоз всего поголовья КРС старше полугода (после прекращения колострального иммунитета), независимо от формы собственности и численности стада, пока нет ни в одном районе страны [5].

В связи с длительным инкубационным периодом данной болезни её профилактика опирается на регулярный скрининг и своевременное выявление инфицированных животных с помощью методов лабораторной диагностики.

Для обнаружения серологических маркёров инфекции ВЛКРС разработана широкая гамма методов, в том числе реакция связывания комплемента [6]; реакция иммунодиффузии (РИД) - данный тест для диагностики лейкозной инфекции известен под названием AGID (agar gel immunodiffusion) [7, 8]; радиоиммуноанализ [6]; иммуноферментный анализ (ИФА) [9, 10]; реакция иммунофлуоресценции (РИФ) [11, 12].

Большая часть генетического материала ВЛКРС в организме заражённого животного существует в форме провируса, интегрированного в геномную ДНК лимфоцитов. Генодиагностика лейкозной инфекции нацелена на выявление последовательностей провируса [13-19].

Одной из важных причин того, почему в Казахстане сохраняется высокий эпизоотический потенциал лекоза, является высокая стоимость импортных тест-систем. Разработка средств лабораторной диагностики и технологий производства таких тестов, которые могли бы производиться в стране для импортозамещения и снижения стоимости тест-систем на нашем рынке, является важной задачей.

Целью работ, описанных в данной статье, являлась оптимизация методов генодиагностики инфекции ВЛКРС, разработка лабораторных прототипов наборов для выделения ДНК из крови и для проведения диагностической ПЦР в реальном времени (ПЦР-РВ).


Материалы и методы


Образцы крови КРС


В качестве материала для исследований использовали образцы крови взрослых коров черно-пестрой породы, случайно отобранных для исследования на молочно-товарной ферме «Раскол» Алматинской области, «МК-1» базе №4 Куйбышевского района, Акмолинской области. Это хозяйство является племенным. Были обследованы 112 взрослых коров, полученных из молочно-товарной фермы МК-1, базы №4 Куйбышевского района Акмолинской области.

Все животные на момент взятия крови не имели клинических признаков лейкоза. Сбор образцов (5 мл) проводили с помощью вакуумированных пробирок для взятия крови, содержащих ЭДТА в качестве антикоагулянта (Single use blood collection system, производства C.D. Rich, Китай).


Иммуноферментный анализ


Сыворотки от крупного рогатого скота предварительно исследовали с использованием коммерческой тест-системы для иммуноферментной диагностики лейкоза ТОО «Бицентр».


Компоненты набора для выделения ДНК из крови


Авторы данной статьи выполнили предварительные исследования по оптимизации состава растворов и ДНК-сорбента, включённых в лабораторный прототип набора для выделения ДНК из стабилизированной крови. Ниже приведены состав и способы приготовления соответствующих компонентов:

Компонент №1. Буфер для лизиса эритроцитов (ELB, 1X): 150 мМ хлорид аммония (NH4Cl), 1 мМ бикарбонат калия (KHCO3), 0,1 мМ ЭДТА; pH раствора доводят до 7,2.

Компонент №2. Буфер для лизиса-сорбции (BB, 1X): 6M гуанидина тиоцианат (GuaSCN), 20 мМ ЭДТА, 10 мМ Трис-HCl, 4% Тритон X-100; pH раствора доводят до 6,4.

Компонент №3. Сорбент (силикагель): к 50 мл высокочистой воды (Milli-Q H2O) добавляют 6 г силикагеля (SiO2, Sigma Cat# S-5631). Суспендируют силикагель в воде интенсивным встряхиванием и оставляют суспензию в покое для осаждения тяжёлых фракций. Через 12 ч. удаляют верхние 43 мл взвеси. К оставшимся 7 мл густой суспензии силикагеля в воде добавляют 0,06 мл 10M соляной кислоты. Суспензию встряхивают до гомогенного состояния и разделяют на аликвоты по 0,5 мл в пробирки с плотными (закручивающимися) пробками. Перед использованием аликвоты суспензии силикагеля тщательно встряхивают.

Компонент №4. Раствор для отмывки белков (PWB, 1X): к 260 мл буфера для лизиса-сорбции (BB) добавляют 700 мл этилового спирта (96%) и 40 мл воды, перемешивают.

Компонент №5. Буфер для отмывки солей (SWB, 1X): 60% этанол, 50 мМ NaCl, 10 мМ Трис-HCl, 0.5 мМ ЭДТА; pH раствора доводят до 7,4.

Компонент №6. Буфер для элюции (EB, 1X): 10 мМ Трис-HCl, 0,5 мМ ЭДТА; pH раствора доводят до 8,5.


Процедура выделения ДНК из крови


Выделение геномной ДНК проводят из лейкоцитарной массы, которую получают путём лизиса эритроцитов крови осмотическим шоком с последующей отмывкой белых клеток крови от мембран (теней) эритроцитов и гемоглобина.

К 300 мкл цельной стабилизированной крови добавляют 900 мкл буфера для лизиса эритроцитов (ELB), перемешивают и оставляют при комнатной температуре на 10 минут. Пробы центрифугируют при 2300 g в течение 5 мин., при комнатной температуре. Супернатант и полужидкий ярко-красный слой мембран эритроцитов удаляют с плотного осадка лейкоцитов. К пробам добавляют 500 мкл ELB, ресуспендируют осадок и повторно осаждают лейкоциты центрифугированием, как описано выше. После удаления супернатанта получают осадок белого или кремового цвета, лейкоцитарную массу.

К лейкоцитарной массе добавляют 900 мкл буфера для лизиса-сорбции (BB), перемешивают и инкубируют при 65°С, 10 мин. После этого пробам дают остыть до комнатной температуры и добавляют 40 мкл сорбента (компонент №3). Смесь с сорбентом перемешивают до образования однородной суспензии и инкубируют при комнатной температуре, 10 мин. Сорбент осаждают центрифугированием (2300g, 5 мин, при комнатной температуре). Удаляют супернатант. На этом этапе ДНК, выделенная из ядер лейкоцитов, находится в форме, связанной с силикагелем.

Для удаления примесных компонентов (белков и липидов) проводят последовательные отмывки буферами PWB, SWB и этанолом. Для этого добавляют к осадку сорбента, полученному на предыдущей стадии, 900 мкл буфера для отмывки белков (PWB) и ресуспендируют силикагель в PWB до образования однородной суспензии. Далее сорбент осаждают из PWB центрифугированием, как описано выше, и удаляют супернатант. К пробам (осадкам) добавляют 900 мкл буфера для отмывки солей (SWB) и повторяют ресуспендирование и осаждение. После удаления SWB аспирацией добавляют к пробам 500 мкл этанола (96%). Ещё раз повторяют ресуспендирование и осаждение. По окончании последней отмывки этанол из пробирок удаляют аспирацией, а его осадки высушивают при 55°С до исчезновения видимой жидкой фазы.

Последняя стадия выделения ДНК заключается в десорбции ДНК с сорбента в низкосолевой буфер при нагревании. Осадок сорбента с адсорбированной на нём ДНК ресуспендируют в 100 мкл буфера для элюции (EB). Суспензию в EB инкубируют при 55°С в течение 5 мин. Силикагель осаждают центрифугированием при 10,000 об/мин (9300 g), 5 мин. Жидкую фазу - раствор, содержащий выделенную ДНК – используют в качестве матрицы в ПЦР без дальнейшей очистки.


Праймеры и меченые пробы


Последовательности праймеров и меченых проб для использования в ПЦР реального времени (ПЦР-РВ) по технологии Taq-man приведены в таблице 1.


Таблица 1

Последовательности праймеров 1


Праймер

Последовательность (5’-3’)

Нацелен на последовательность

№ группы олигонуклеотидов

LTR-S

GCTGACCTCACCTGCTGATA

ВЛКРС, область LTR

1

LTR-AS

CAGAAGGTCTCGGGAGCAAG

ВЛКРС, область LTR

1

ENV-S

TCTYCCTGGKTAATCTYTCT

ВЛКРС, ген env

2

ENV-AS

GTKAGYCTCTGMTGGCTAAG

ВЛКРС, ген env

2

ENV-S1

CCTGATCACCTTTTCTTTACATAA

ВЛКРС, ген env

3

ENV-AS1

CCAACATATAGCACAGTCTG

ВЛКРС, ген env

3

Pol-S

CCTACAACCCCACAAGTTC

ВЛКРС, ген pol

4

Pol-AS

GTCTTTAGAATTGGTAGGAGGTT

ВЛКРС, ген pol

4

SINE-S

GACTGAGCGACTTCACTTTCA

короткие диспергированные ядерные элементы (SINE)

5

SINE-AS

GGATTCTCCAGGCAAGAACA

короткие диспергированные ядерные элементы (SINE)

5

Cytb-F

CCCGATTCTTCGCTTTCCAT

цитохром B

6

Cytb-R

CTACGTCTGAGGAAATTCCTGTTG

цитохром B

6

18S-F

TGCGAATGGCTCATTAAATC

ген 18S рРНК

7

18S-R

GTTGGTTTTGATCTGATAAATGC

ген 18S рРНК

7

18S2S

GCATTTGCCAAGAATGTTTTCA

ген 18S рРНК

8

18S2AS

GCGGGTCATGGGAATAACG

ген 18S рРНК

8

1 Для вырожденных положений использована IUPAC/IUB нотация:

Y = (C или T), K = (G или T), M = (A или C).



Таблица 1 (продолжение)

Последовательности зондов Taq-man1


Назва

ние

Последовательность (5’-3’)

Модифи

кация

5’-конца

Модификация 3’-конца

№ группы олигонуклеотидов

LTR-P

(6FAM)-AACGCTTCTGGTGCCGCTAACTCGACAGG-(BHQ-1)

6-FAM

BHQ-1

1

ENV-P

(6FAM)-CTCACTGGAATTAATGTAGCCGTGTCTGC-(BHQ-1)

6-FAM

BHQ-1

2

ENV-P1

(6FAM)-CCCTCAACCCGACTTCCCTCAG-(BHQ-1)

6-FAM

BHQ-1

3

Pol-P

(6FAM)-AAGTTTGAGCAGTCCATTTGTCCGTTCTACT-(BHQ-1)

6-FAM

BHQ-1

4

SINE-P

(HEX)-TTGGAGAAGGAAATGGCAACCCACTCC-(BHQ-1)

HEX

BHQ-1

5

Cytb-P

(HEX)-TCCACCTACTATTCCTCCACGAAACAGGCT-(BHQ-1)

HEX

BHQ-1

6

18S-P

(HEX)-TGGTCGCTCGCTCCTCTCCTACT-(BHQ-1)

HEX

BHQ-1

7

18S2Pro

(HEX)-AGTTCCGACCATAAACGATGCCGACCG-(BHQ-1)

HEX

BHQ-1

8

1флуоресцентные метки 6-FAM, 6-флуоресцеин; HEX, 5-гексахлоро флуоресцеин. Тушитель флуоресценции BHQ-1, Black Hole Quencher-1 (Bioresearch Technologies, Inc.).



ПЦР в реальном времени


ПЦР проводят в амплификаторах с возможностью детекции результатов в реальном времени Corbett RotorGene 6000 или BioRad IQ5. Реакционная смесь содержит 1X буфер для ПЦР (10X ПЦР-буфер имеет состав: 650 мМ Tris-HCl pH 8,9; 160 mM (NH4)2SO4; 30 мМ MgCl2; 0,5% Tween 20), по 0,2 mM каждого dNTP, на каждую пробу по 1 е.а. ДНК-полимеразы Taq (Fermentas), а также праймеры и флуоресцентно меченые зонды в подобранных концентрациях. Общий объем реакционной смеси составляет 15 мкл, включая 2 мкл раствора геномной ДНК, полученного в ходе выделения вышеописанным методом (20-100 нг ДНК). Режим ПЦР предусматривает активацию фермента и плавление ДНК при 96°С в течение 10 мин., затем термоциклирование по программе: 96°С – 15 сек., 60°С - 15 сек., 72°С – 1 мин. в течение 50 циклов с измерением флуоресценции на третьем сегменте цикла (при 72°С).

В случае мультиплексной ПЦР реакционная смесь содержит праймеры и зонды, нацеленные на последовательности провируса ВЛКРС и на выбранные гены генома коровы (т.е., проба для мультиплексной ПЦР содержит смесь шести олигонуклеотидов).

В качестве негативного контроля при диагностической амплификации последовательностей провируса ВЛКРС использовали ДНК здоровой коровы без серологических маркёров лейкоза. В мультиплексной ПЦР оптимизацию и проверку системы внутреннего контроля проводили с использованием пробы, не содержащей последовательностей из генома коровы, в качестве которой использовали чистый буфер для элюции.


Результаты


Выход и чистота выделяемой ДНК


В таблице 2 представлены результаты типичного эксперимента по выделению ДНК из ЭДТА-стабилизированной цельной крови коров с использованием сорбции на силикагель. В данном эксперименте кровь выделяли из 10-ти проб крови от разных животных. Выход ДНК варьировал в диапазоне 0,3 - 1,8 мкг из 100 мкл крови; средняя концентрация ДНК в конечных препаратах составила 20,6 нг/мкл. Для определения чистоты выделенной ДНК её осаждали из буфера EB этанолом, растворяли в воде и определяли отношение оптических плотностей на 260 нм и 280 нм с использованием спектрофотометра Nanodrop, откалиброванного по воде. Отношение А260/А280 близкое к 1,8 указывает на то, что ДНК обладает высокой чистотой.


Таблица 2


Результаты выделения геномной ДНК из крови КРС,

молочно-товарная ферма МК1, база №4, Куйбышевский район, Акмолинская область


Код животного

Концентрация ДНК (нг/мкл)

Выход ДНК из 100 мкл крови (мкг)

А260/А280

36П

51,6

1,7

1,7

16П

34,9

1,2

1,8



44,0

1,5

1,7

56П

39,2

1,3

1,7

46П

33,8

1,1

1,7



53,4

1,8

1,8



25,7

0,9

1,7

42П

48,1

1,6

1,8

78П

34,0

1,1

1,7

66П

41,6

1,4

1,7


Дизайн праймеров


В таблице 1 представлены последовательности праймеров и зондов, которые сравнивали по эффективности применения в ПЦР для выявления последовательностей провируса ВЛКРС (группы олигонуклеотидов №1-4, таблица 1) и в качестве внутреннего контроля - для амплификации участков ядерного или митохондриального геномов Bos taurus (группы олигонуклеотидов №5-8). Схема генома ВЛКРС и последовательности амплификатов с указанием положения праймеров и зондов приведена на рис. 1.

Для нацеливания праймеров и зондов на консервативные участки вирусного генома последовательности соответствующих генов загружали из базы Genbank и строили множественные сравнения (элайнменты). Были построены элайнменты 6-ти последовательностей полноразмерных геномов ВЛКРС, депонированных в Genbank, 62-х последовательностей области LTR, 100 последовательностей гена env, 39-ти последовательностей гена pol. Все выбранные последовательности праймеров были предварительно проверены in silico на специфичность с использованием программы Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/).

Дизайн праймеров и зондов проводили с использованием программы Beacon Designer 7.9 (Premier Biosoft, Inc.). При выборе последовательностей олигонуклеотидов для ПЦР учитывали следующие параметры: расчётная температура отжига праймеров находилась в пределах +58°С …+60°С, а для зондов +68°…+70°С; не допускали наличие нуклеотида G на 5‘ конце подобранного зонда; исключали последовательности, содержащие тринуклеотид GGG.




Рис. 1. A. Схема генома ВЛКРС. Затемнёнными прямоугольниками над генетической картой показаны фрагменты генома, используемые в качестве мишеней в ПЦР.

B. Последовательности амплификатов с указанием положения праймеров и зондов


Оптимизация реакционных условий ПЦР


В ходе первоначально выполненных экспериментов выбрали наиболее эффективно работающие праймеры и зонды. Эффективность системы ПЦР оценивали по её способности дискриминировать пробы от коров, имеющих и не имеющих серологические маркёры, и по номеру критического цикла (Ct), т.е. цикла, в котором флуоресценция образца превышает вычисленное пороговое значение (чем Ct меньше, тем эффективнее амплификация). Наилучшие результаты были показаны для праймеров ENV-S1, ENV-AS1 и зонда ENV-P1 (для выявления провируса), праймеров 18S2AS, 18S2S и зонда 18S2Pro (внутренний контроль).

Дальнейшую оптимизацию ПЦР проводили, варьируя концентрации праймеров и зондов. В каждом эксперименте парные прямой и обратный праймеры использовали в равной концентрации. Для праймеров ENV-S1, ENV-AS1, 18S2S, 18S2AS были испытаны три рабочие концентрации (0,2 пМ/мкл, 0,4 пМ/мкл, 0,8 пМ/мкл), для соответствующих зондов - две рабочие концентрации (0,1 пМ/мкл, 0,2 пМ/мкл). Результаты типичного эксперимента по оптимизации отношения концентраций праймер/зонд показаны на рис. 2. В качестве матрицы для амплификации в данном эксперименте использован один образец ДНК от серопозитивной коровы. Были найдены оптимальные концентрации праймеров и зондов для ПЦР-РВ в мультиплексном варианте. В дальнейшей работе праймеры ENV-S1, ENV-AS1 использовали в рабочей концентрации 0,8 пМ/мкл, зонд ENV-P1 - 0,2 пМ/мкл; праймеры 18S2S, 18S2AS - 0,2 пМ/мкл, зонд 18S2Pro - 0,2 пМ/мкл (рис. 3).




а) праймеры - 0,8 пМ/мкл; зонд - 0,2 пМ/мкл; б) праймеры - 0,4 пМ/мкл; зонд - 0,2 пМ/мкл;

в) праймеры - 0,2 пМ/мкл; зонд - 0,2 пМ/мкл; г) праймеры - 0,8 пМ/мкл; зонд - 0,1 пМ/мкл;

д) праймеры - 0,4 пМ/мкл; зонд - 0,1 пМ/мкл; е) праймеры - 0,2 пМ/мкл; зонд - 0,1 пМ/мкл


Рис. 2. Результаты ПЦР в реальном времени для выявления последовательностей провируса ВЛКРС в зависимости от концентрации праймеров ENV-S1, ENV-AS1 и зонда ENV-P1


Результаты исследования 10-ти проб крови КРС (таблица 1) в мультиплексной ПЦР-РВ показаны на рис. 3. Результаты исследования легко интерпретируемы: внутренний контроль (фрагмент гена 18S рРНК) амплифицируется во всех пробах 36П-8П (рис. 3а). Последовательности провируса ВЛКРС выявлены в 4 образцах (4/11, 36%) (рис. 3б).





Образцы из молочно-товарной фермы МК1, база №4, Куйбышевский район, Акмолинская область.

а) внутренний контроль; б) диагностическая реакция. Положительные пробы: 36П, 8П, 6П, 78П


Рис. 3. Результаты мультиплексной ПЦР-РВ


Сравнение результатов ПЦР-РВ с данными ИФА


Эффективность применения описанной мультиплексной тест-системы ПЦР-РВ для диагностики лейкоза КРС была проверена с использованием коллекции проб крови (n=112 образца) от коров, случайным образом отобранных в одном из хозяйств Акмолинской области. Пробы крови были разделены на две части, из одной части выделяли ДНК по описанной выше технологии, вторая часть была использована для получения плазмы для исследования в ИФА. Сравнение результатов выявления маркёров лейкоза методами ПЦР и ИФА приведено в таблице 3. Из 61 образца, положительного в ИФА, 49 являются положительными в ПЦР РВ. 12 образцов из 61 не показали положительных результатов при проверке методом ПЦР РВ. Количество проб, отрицательных по ИФА и ПЦР РВ составило 51. По результатам исследования, не выявлено образцов, положительных в ПЦР РВ и отрицательных в ИФА. Для 89% проб результаты совпали; принимая в данном эксперименте ИФА с использованием коммерчески доступной тест-системы в качестве «золотого стандарта» чувствительность разработанного протокола ПЦР-РВ составила 80% (49/61), его специфичность – 100%.


Таблица 3

Сравнение результатов ПЦР-РВ и ИФА





ПЦР РВ

Pos

ПЦР РВ

Neg

ИФА Pos

49

12

ИФА Neg

0

51


Обсуждение


Методы обнаружения в диагностических пробах ДНК или РНК, специфичных для инфекционных патогенов, приобрели большое значение в медицине и ветеринарии. Несмотря на разнообразие технологий молекулярной диагностики, во всех случаях материал для исследования - нуклеиновые кислоты – должен быть выделен из биопроб и очищен от интерферирующих примесей. В данной статье описан лабораторный прототип набора для выделения ДНК из цельной стабилизированной крови.

Описанный в данной статье метод выделения ДНК использует обратимую адсорбцию ДНК на специально подготовленный сорбент с последующей элюцией ДНК в буфер с низкой ионной силой. Метод хорошо описан в научной литературе и патентах [20-23]. Для выделения ДНК по указанному методу можно применять готовые наборы, которые выпускают большое количество производителей (Qiagen, Promega, Millipore, Sigma и др.). Компании-производители не раскрывают своих ноу-хау и, с учётом немалой цены наборов на отечественном рынке, это создаёт неудобства для отечественных ветеринаров, медиков и биологов. В данной статье описаны химические составы и протоколы приготовления всех компонентов лабораторного прототипа набора для выделения ДНК методом адсорбции-элюции. Приведены выход и чистота выделенных нами ДНК, которые полностью соответствуют характеристикам препаратов, получаемых с помощью коммерческих наборов производства Promega.

Высокое качество ДНК достигается за счёт: 1) очистки проб от гемоглобина путём лизиса эритроцитов и отделения лейкоцитарной массы; 2) лизиса ядросодержащих клеток в растворе, содержащем детергент и т.н. хаотропный агент; 3) адсорбции ДНК на сорбент с высокой ёмкостью по отношению к ДНК (800-1000 нг/мг); 4) использования нескольких последовательных отмывок сорбента, связанного с ДНК, буферами с убывающей ионной силой.

Хаотропные агенты разрушают макромолекулярные структуры высокого порядка (третичные структуры белков), солюбилизируют клеточные мембраны, но не денатурируют ДНК и РНК. Авторы опубликованных в литературе протоколов используют разные хаотропные агенты, предпочтительно применяются гуанидина тиоционат (GuaSCN) или гуанидина гидрохлорид (GuaHCl), рекомендуемый диапазон рабочих концентраций которых от 1M до 4M для GuaSCN и 6-8M для GuaHCl. В ряде источников описано использование перхлората натрия (NaClO4), иодидов натрия или калия (NaJ, KJ) в рабочей концентрации 4M [20-23].

Нуклеиновые кислоты обладают природной способностью в присутствии хаотропных солей адсорбироваться из раствора обратимым образом на поверхность кристаллических материалов с определённой периодической структурой поверхности [22]. Силикагель (кремнезём, SiO2), мелкодисперсное стекло, кварц, диатомовая земля или цеолиты являются примерами таких материалов. Способность хаотропных солей облегчать селективную адсорбцию ДНК происходит по причине того, что в высоких концентрациях они снижают растворимость полярных соединений (например, нуклеиновых кислот), но повышают растворимость в воде неполярных веществ и макромолекул, имеющих гидрофобные участки (например, белков) [24]. В водных растворах макромолекулы окружены упорядоченными молекулярными структурами, состоящими из ориентированных молекул воды, т.н. гидратными оболочками. Стабильность гидратных оболочек обеспечена водородными связями между молекулами воды. Именно наличие гидратных оболочек приводит к растворимости ДНК в воде. Когда в растворе в высоких концентрациях (>2M) присутствуют хаотропные ионы, молекул воды становится недостаточно, чтобы полностью их сольватировать. Это приводит к росту роли ион-дипольных взаимодействий между гидратированными ионами и снижению роли водородных связей, гидратные оболочки вокруг молекул ДНК разупорядочиваются, ДНК становится доступной для взаимодействия с гидрофобной поверхностью кремнезема [24].

Отмывка сорбента, несущего адсорбированную на нём ДНК, заключается в ресуспендировании в буфере с ионной силой, пониженной по сравнению с условиями оптимальной адсорбции. Это приводит к диссоциации с сорбента контаминирующих примесей, способных лишь к неспецифическому связыванию с силикагелем (белки, гликопротеины крови). Присутствие в отмывочных буферах органических растворителей (этанол или изопропанол) удерживает ДНК в адсорбированном состоянии.

Количественная элюция ДНК с сорбента происходит на последней стадии протокола в буфер с очень низкой ионной силой (10 мМ Трис-HCl, 0,1 мМ ЭДТА) при нагревании (50-65°С).

Инфекция ВЛКРС обыкновенно протекает с длительным периодом бессимптомного и субклинического течения, что делает незаменимым применение методов лабораторной диагностики для раннего выявления больных животных. В настоящее время лабораторным тестом, на который опирается система профилактических мероприятий, является РИД (AGID). РИД чрезвычайно прост в постановке, но значительно уступает в чувствительности более современным методам иммуноанализа, таким как ИФА и иммуноблот [24]. Невозможность автоматизации делает РИД не очень удобной реакцией при массовых исследованиях. Наиболее чувствительным тестом для подтверждения диагноза после истечения острого периода вирусной инфекции, как у животных, так и у человека, является ИФА. В скрининговых эпизоотологических исследованиях чувствительность ИФА для выявления случаев инфекций КРС варьирует от 60 до 80% [25]. Все животные-вирусоносители в стаде в исследованиях поперечного формата (т.е. с однократным тестированием), обыкновенно, не выявляются ни одним серологическим методом. В системе профилактических мероприятий ПЦР пока занимает нишу высокоспецифичного метода, пригодного для использования в качестве подтверждающего теста. Расширение перспектив использования ПЦР связано с ранней диагностикой и с тем обстоятельством, что телята, которых выкармливали молозивом или молоком от серопозитивных коров, обычно приобретают материнские антитела. Для выявления зараженных телят в период действия колострального иммунитета наиболее предпочтительным методом является ПЦР. По литературным данным, эффективность ПЦР в скрининговых исследованиях поголовья сравнима с эффективностью ИФА (выявление до 80% больных животных при однократном обследовании) [24]. Таким образом, для максимального выявления всех инфицированных BJIKPC животных необходимо комбинированное использование серологических и молекулярных методов.

Чувствительность ПЦР в режиме реального времени определяется, прежде всего, подбором и дизайном эффективных праймеров и зондов. По нашим данным, на имеющейся панели образцов (n=112) специфичность ПЦР-РВ составила 100%, тогда как чувствительность - только 80%. Данное наблюдение может свидетельствовать в пользу циркуляции в обследованном стаде и, возможно, на территории нашей страны, изолятов ВЛКРС, отличающихся по последовательностям генома от прототипных изолятов из базы Genbank, использованных при расчётах праймеров и зондов. У авторов данной статьи не было финансовых ресурсов для того, чтобы исследовать последовательности генома казахстанских изолятов ВЛКРС. Однако данная работа однажды должна быть выполнена, как для адаптации диагностических тестов к местным изолятам, так и для доказательного описания циркуляции возбудителя посредством молекулярно-эпизоотологических подходов.

Необходимость улучшения материальной базы и уровня оснащённости ветеринарной службы делает актуальными создание и апробацию прототипов наборов для ПЦР, производимых или по зарубежной лицензии, или с использованием технологий, разработанных в стране.


Литература


1. Bumy A., Bruck C., Chantrenne H. (1980). Bovine leukemia virus: molecular biology and epidemiology. Viral epidemiology and oncology. - 231-289.

2. House J.A., Glover F.L., House C. (1975). Current aspect of bovine leukemia. Proc Annu Conv Am Assoc Bovine Pract 8: 147-150.

3. Кабдулова С.С. Эпизоотологический мониторинг при лейкозе крупного рогатого скота в Республике Казахстан и Акмолинской области // Вестник науки КАТУ им. С. Сейфуллина. – 2010. - №3. – С. 66-71.

4. Отраслевой мастер-план «Развитие производства молока и молокопродуктов» Министерства сельского хозяйства РК //

http://www.minagri.kz/images/master_plan/ms_pl_moloko.pdf.

5. Дробот Е.В. Результаты изучения генотипического разнообразия вируса лейкоза крупного рогатого скота и особенности эпизоотологического и гематологического проявления лейкоза. – Новосибирск, 2007. - С. 110.

6. Miller J.M., Van der Maaten MJ. (1974). A complement-fixation test for bovine leukemia (C-type) virus. J Natl Cancer Inst 53: 1699-1702.

7. Miller J.M., Olson C. (1972). Precipitating antibody to an internal antigen of C-type virus associated with bovine lymphosarcoma. J Natl Cancer Inst 49:1459-1461.

8. Miller J.M., Van der Maaten MJ. (1976). Serologic detection of bovine leukemia virus infection. Vet Microbiol 1: 195-202.

9. Have P., Hoff-Jorgensen R. (1991). Demonstration of antibodies against bovine leukemia virus (BLV) by blocking ELISA using polyclonal anti-BLV immunoglobulin. Vet Microbiol 27:221-229.

10. Portetelle D, Bruck C, Mammerickx M, Burny A. ( 1983). Use of monoclonal antibody in an ELISA test for the detection of antibodies to bovine leukaemia virus. J Virol Methods 6: 19-29.

11. Graves D.C., Diglio C.A., Ferrer J.F. (1977). A reverse transcriptase assay for detection of the bovine leukemia virus. Am J Vet Res38:1739-1744.

12. Roberts D.H., Lucas M.H., Wibberley G, Chasey D. (1982). An investigation into susceptibility of cattle to bovine leukosis virus following inoculation by various routes. Vet Rec 110:222-224.

13. Jacobs R.M., Song Z, Poon H. (1992). Proviral detection and serology in bovine leukemia virus-exposed normal cattle and cattle with lymphoma. Can J Vet Res 56:339-348.

14. Kelly E.J., Jackson M.K, Marsolais G. (1993). Early detection of bovine leukemia virus in cattle by use of the polymerase chain reaction. Am J Vet Res 54:205-209.

15. Kuzmak J, Skorupska A, Moussa A, Grundboeck J. (1993). Application of non-radioactive method of DNA detection in the diagnosis of bovine leukaemia virus infection. Bull Vet InstPulawy 37:3-8.

16. Murtaugh M.P., Lin G.F., Haggard D.L. (1991). Detection of bovine leukemia virus by the polymerase chain reaction. J Virol Methods 33:73-85.

17. Naif H.M., Brandon R.B., Daniel R.C., Lavin M.F. (1990). Bovine leukaemia proviral DNA detection in cattle using the polymerase chain reaction. Vet Microbiol 25:117-129.

18. Naif H.M., Daniel R.C., Cougle W.G., Lavin M.F. (1992). Early detection of bovine leukemia virus by using an enzyme-linked assay for polymerase chain reaction-amplified proviral DNA in experimentally infected cattle. J Clin Microbiol 30:675-679.

19. Sherman M.P., Erlich G.D., Ferrer J.F. (1992). Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction. J Clin Microbiol 30:185-191.

20. Zielenski R., Geissler K., Walter T. (2009). US 7,491,495 В2. C12Q 1/68:22.

21. Евтушенко В.И. (1998). РФ 2116795. А61К35/66, С07Н21/04:5.

22. Wang T.Y., Wang L., Zhang J.H. (2011) A simplified universal genomic DNA extraction protocol suitable for PCR Genetics and Molecular research:519-525.

23. Bost D.F., Greenfield L.( 2010). US 2010/0021905 A1 C12Q 1/68:39.

24. Collins, K.D. (1997). Charge density-dependent strength of hydration and biological structures. Biophys. J. 72: 65–76.

25. Верховский О.А. и соавт. Иммуноферментный анализ в диагностике крупного рогатого скота // Ветеринария. – 2002. - №12. – С. 8-10.


Түйін


Энзоотикалық лейкоз ІҚМ-дамыған және дамып келе жатқан елдерде, сонын ішінде Қазақстан елінде соңғы он жылдықта бірінші орында тұрақты болып тұрған,өнімді мал басы арасында кең таралған ірі қараның инфекциялы ауруы. ҚР ветеринариялы қызметтердің көрсеткіші бойынша, қазіргі таңда өнімді мал басы арасында лейкоз маркерларының кездесуі жоғарланып келеді,сондықтан профилактикалық шараларды кушейту және де AGID, ИФТ және ПТР ұсынылған әдістерді қолдана отырып шаруашылықты диагностикалық заттармен қамтамасыз ету керек. Мұндай тест-системалар отандық тауаларда импотрты немесе импорттілеу компонентеринде Қазақстанда жинақталған. Компонентті ветеринария ушін жасалған прототивті тест-систеаларды отандық технологиялық базада өндеу маңызды.

Мақалада ПТР диагностикасында зерттеуде сиыр қанандагы ДНҚ-да бөлініп алынатын әдіс көрсетілген. Қандағы ДНҚ бөліп алуда зертханалық прототипті жиынды, барлық компоненттерди дайындау хаттамалары және химиялық құрамдар жасалынды.

ІҚМ лейкоз вирусты инфекциясының диагностикасы үшін индикация нәтижесінде нақты уақытта (ПТР-РВ) ПТР тест-системасы өнделді.Жиында праймерлер тізбегі,зондылары және ПТР-РВ оптималды реакциялы усынысы көрсетілген. ПТР-РВ тест-системасының зертханалық прототипті инфекцияланған жануарлардың ДНҚ-да болатын провирусты анықтауға және тестің орындауының сапасын бақылауын қолайшлы етеді, сиырдын геномының тізбектелуіне негізделген ішкі сапа амплификациясы бар.Асыл тұқымды шаруашылықтардан ересек сиырлардан алынған (n=112) үлгі жинақтасын зерттеуде ИФТ және ПТР-РВ нәтижелері 89% сәйкестік болды, сонымен бірге ИФТ коммерциялық қолжетімді «алтын стандарт» ретінде тест-система, сезімталдығы және телімділігі ПТР-РВ мен 80 және 100%,сәйкесинше.


Summary


Enzootic bovine leukemia is an infectious disease of cattle, which holds the first place in prevalence in the livestock in both developed and developing countries, including Kazakhstan. According to the state veterinary service, prevalence of leukemia markers in the cattle is growing, which requires strengthening of the preventive policies and improvement in availability of diagnostic tools, particularly AGID, ELISA and PCR. Currently, such test systems in the domestic market are either imported, or assembled in Kazakhstan from the imported components. Of substantial importance is the development of laboratory prototypes of test systems for veterinary medicine produced with utilization of domestic technologies.

This paper describes a method for isolating of DNA from bovine blood, which is suitable material for diagnostic PCR. The paper presents chemical compositions and preparation protocols for all components of a prototype kit for the blood DNA isolation.

The real time polymerase chain reaction (RT-PCR) was used to detect bovine leukemia virus in bovine blood. This article describes the sequences of primers and probes, and optimal reaction conditions for RT-PCR. The RT-PCR system detects an integrated provirus which is present in the DNA of infected animals and, for convenience of quality control, it contains an internal amplification control. The study of panel of bovine samples (n=112) found good correlation between the ELISA and RT-PCR, i.e. concordance for 89% of samples, and assuming the commercial ELISA test system as a «gold standard», the sensitivity and specificity of RT-PCR were 80 and 100%, respectively.



Добавить документ в свой блог или на сайт
Ваша оценка этого документа будет первой.
Ваша оценка:

Похожие:

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconУдк 619: 616. 98. 578. 828. 11Л современные аспекты серологической диагностики энзоотического лейкоза крупного рогатого скота

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconУдк 619: 616. 9(06) 619: 578. 824. 11 Разработка и оптимизация условий постановки тест-системы для диагностики бешенства сэндвич методом твердофазного иммуноферментного анализа
Ргп «Научно-исследовательский институт проблем биологической безопасности» кн мон рк, пгт. Гвардейский, Кордайский район, Жамбылская...

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconУтвердить план оздоровления крупного рогатого скота от лейкоза на 2011 год (приложение). Постановление подлежит официальному опубликованию
Ростовской области от 12. 05. 2005 №315-зс «Об областной целевой программе оздоровления крупного рогатого скота от лейкоза на 2005...

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconОсобенности лейкоза крупного рогатого скота и современные методы его диагностики

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconОценка эффективности различных методов диагностики инфекции вируса лейкоза крупного рогатого скота 16. 00. 03 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconРезультаты изучения генотипического разнообразия вируса лейкоза крупного рогатого скота и особенности эпизоотологического и гематологического проявления лейкоза 16.

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconЭффективность диагностических тестов в выявлении вируса лейкоза крупного рогатого скота в оздоравливаемых от лейкоза стадах 06. 02. 02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconПрофилактика лейкоза крупного рогатого скота

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconМолекулярная генодиагностика лейкоза крупного рогатого скота 03. 00. 04 биохимия

Удк 619: 616-07 Метод выделения ДНК и тест-система пцр в реальном времени для диагностики лейкоза крупного рогатого скота iconПроблемы, связанные с диагностикой лейкоза крупного рогатого скота

Поместите кнопку у себя на сайте:
Образование


База данных защищена авторским правом ©cow-leech 2000-2013
обратиться к администрации | правообладателям | пользователям
COW-LEECH.RU